Object Oriented Programming עזאם מרעי המחלקה למדעי המחשב אוניברסיטת בן-גוריון

Size: px

Start display at page:

Download "Object Oriented Programming עזאם מרעי המחלקה למדעי המחשב אוניברסיטת בן-גוריון"

Ezra Goodman
5 years ago
Views:

1 Object Oriented Programming עזאם מרעי המחלקה למדעי המחשב אוניברסיטת בן-גוריון

2 2 General Information Instructor: Azzam Maraee Office: building 37, room Course WEB site:

3 3 Book and credit for the slides We will mostly follow: The slides are based on Timothy Budds s slides for the book

4 4 Grading Home work: Programming exercises 40% of the total grade Via the submission system In class exam: Theoretical problems 60% of the total grade

5 5 Roadmap In this chapter we begin our exploration of object-oriented programming. Among the topics we will explore: Historical survey of computing and programming What is a paradigm? Why is this term used to describe the object-oriented approach to problem solving? How does language influence thought? Characteristics of the object-oriented way of thinking

6 Brief Historical Survey 2400 BC - Abacus (counting frame). 300 BC - The algorithm of Euclid for computing GCD(x,y) 100 BC - Antikythera mechanism al-khwārizmī systematic approach to solving equations led to algebra.

7 Brief Historical Survey (cont.) 1842 Ada Lovelace writes programs for Babbage s analytical engine The first electronic computer s The software crisis The United States Department of Defense define Steelman language requirements that lead to development of Ada programming language s - Object Oriented Programming becomes dominant programming methodology.

totally unlike anything that has come before in programming languages OOP is

8 8 Conflicting Objectives Along the way, we'll try to convince you the validity of the following two assertions: OOP is a revolutionary idea, totally unlike anything that has come before in programming languages OOP is an evolutionary step, following naturally on the heels of earlier programming abstractions

9 9 Why has OOP remained popular for so long? OOP has been the dominant programming paradigm for more than twenty years. Why is it so popular? Proven record of success Scales well from small problems to large Resonant similarity to techniques for thinking about problems in other domains Nevertheless, programming is still a task that requires skill and learning

10 The Software Werewolf Software is like a werewolf it looks normal until the moon comes out and it turns into a monster Missed deadlines Blown

10 10 The Software Werewolf Software is like a werewolf it looks normal until the moon comes out and it turns into a monster Missed deadlines Blown budgets Buggy software We want the silver bullet to kill the monster something to make software costs drop as rapidly as computer hardware costs do.

11 11 There Is No Silver Bullet! As we look to the horizon of a decade hence, we see no silver bullet. There is no single development, in either essence, technology or in management technique, that by itself promises even one order-of-magnitude improvement in productivity, in reliability, in simplicity

12 12 What is software and What is the Software Crisis? Computer programs and associated documentation Software products may be developed for a particular customer or may be developed for a general market What is the software crisis? Major projects are meaning fully late. Software costs more than predicted. Software is difficult to maintain. Poor performance. While hardware costs were decreasing, software costs were rising. requires techniques to control the complexity o large software systems.

13 13 A New Paradigm Object-oriented programming is often described as a new paradigm. We start by considering the definition of this term: Typical example or pattern of something; a model There is a new paradigm for public art in this country A worldview underlying the theories and methodology of a particular scientific subject The discovery of universal gravitation became the paradigm of successful science A set of linguistic items that form mutually exclusive choices in particular syntactic roles English determiners form a paradigm: we can say a book or his book but not a his book. A table of all the inflected forms of a particular verb, noun, or adjective, serving as a model for other words of the same conjugation or declension What does this have to do with computer programming languages?

14 14 "First, the new candidate must seem to resolve some outstanding and generally recognized problem that can be met in no other way. Second, the new paradigm must promise to preserve a relatively large part of the concrete problem solving activity that has accrued to science through its predecessors."

15 15 Programming Paradigm A way of conceptualizing what it means to perform computation and how tasks to be carried out on the computer should be structured and organized. Robert W. Floyd Imperative : Functional : Machine-model based Equations; Expression Evaluation Logical : First-order Logic Deduction Object-Oriented : Programming with Data Types

16 16 Sapir-Whorf Hypothesis Language, Thought, and Reality Selected Writings of Benjamin Lee Whorf language defines the way a person behaves and thinks: Eskimo (or Inuit) languages and snow Arabic languages and camel George Orwell's book 1984: a language entitled "newspeak" created to change the way people think about the government What is true of natural languages is even more true of artificial computer languages

17 17 Example from Computer Languages A student working in DNA research had the task of finding repeated sequences of M values in a long sequence of values: ACTCGGATCTTGCATTTCGGCAATTGGACCCTGACTTGGCCA Wrote the simplest (and therefore, most efficient?) program: DO 10 I = 1, N-M DO 10 J = I+1, N-M FOUND =.TRUE. DO 20 K = 1, M 20 IF X[I+K-1].NE. X[J+K-1] THEN FOUND =.FALSE. IF FOUND THEN CONTINUE Took a depressingly long time.

18 A Better Solution A friend writing in APL found a much better solution by rearranging the data and sorting: A C T C G G positions 1 to M C T C G G A positions 2 to M+1 T C G G A

18 18 A Better Solution A friend writing in APL found a much better solution by rearranging the data and sorting: A C T C G G positions 1 to M C T C G G A positions 2 to M+1 T C G G A T positions 3 to M+2 C G G A T T positions 4 to M+3 G G A T T C positions 5 to M+4 G A T T C T positions 6 to M+5... T G G A C C G G A C C C... Ran surprisingly quickly, thesis saved

19 19 What lead to the discovery? Why did the APL programmer find the better solution? Fortran programmer was blinded by a culture that valued loops, simple programs Sorting is a built-in operation in APL, good programmers try to find novel uses for sorting The fundamental point is that the language you speak leads you in one direction or another But what about the Sapir-Whorf hypothesis, that says there are some thoughts you can express in one language that you cannot express in another?

20 Church's Conjecture In computer science we have the following assertion: Church's Conjecture: Any computation for which there exists an effective procedure can be realized by a Turing machine

20 20 Church's Conjecture In computer science we have the following assertion: Church's Conjecture: Any computation for which there exists an effective procedure can be realized by a Turing machine Anything can be done in any language, but it may simply be easier or more efficient to use one language or another Would you want to write an event-driven GUI interface in Turing machine? Bottom line: Languages lead you, but do not prevent you from going anywhere you want

21 21 Imperative Programming Imperative programming is the traditional model of computation: State / Variables / Assignment / Loops A processing unit is separate from memory, and acts upon memory: The computer is the data manager Wandering through memory, pulling values in memory slots Transforming them in some manner, and pushing results back in some other slots Although this is exactly what happens inside a computer, it is not the way people do for solving problems

22 22 Visualization of Imperative Programming Sometimes called the pigeon-hole model of computation: i: j: 2 3 x: 47 a[1]: a[2]: a[3]: a[4]:

constructed the whole out of pieces that were useless by themselves Why not build a

23 23 Why Not Build a Program out of Computers? Alan Kay thought about this conventional design of the computer, and asked: Why we constructed the whole out of pieces that were useless by themselves Why not build a whole out of pieces that were similar at all levels of detail? (think of fractals) Idea: A program can be build out of little computing agents

24 24 Recursive Design The structure of the part mirrors the structure of the larger unit:

25 25 Kay's Description of Object- Oriented Programming Object-oriented programming is based on the principle of recursive design: 1. Everything is an object 2. Objects perform computation by making requests of each other through the passing of messages 3. Every object has it's own memory, which consists of other objects 4. Every object is an instance of a class. A class groups similar objects 5. The class is the repository for behavior associated with an object 6. Classes are organized into singly-rooted tree structure, called an inheritance hierarchy We can illustrate these principles by considering how we go about solving a problem in real life

26 26 Illustration of OOP Concepts -- Sending Flowers to a Friend To illustrate the concepts of OOP in an easily understood framework, consider the problem of sending flowers to a friend who lives in a different city: Chris is sending flowers to Robin. Chris can't deliver them directly. So Chris uses the services of the local Florist. Chris tells the Florist (named Fred) the address for Robin, how much to spend, and the type of flowers to send. Fred contacts a florist in Robins city, who arranges the flowers, then contacts a driver, who delivers the flowers If we start to think about it, there may even be other people involved in this transaction: There is the flower grower, perhaps somebody in charge of arrangements, and so on.

27 27 Agents and Communities Our first observation is that results are achieved through the interaction of agents, which we will call objects Furthermore, any nontrivial activity requires the interaction of an entire community of objects working together Each object has a part to play, a service they provide to the other members of the community Gardeners Robin Delivery Person Flower Arranger Grower Chris Fred Wholesaler Robbin's Florist

28 28 Elements of OOP - Objects Kay's first principle: 1) Everything is an object Actions in OOP are performed by agents, called instances or objects There are many agents working together in our scenario We have Chris, Robin, the florist, the florist in Robins city, the driver, the flower arranger, and the grower Each agent has a part to play, and the result is produced when all work together in the solution of a problem

29 29 Elements of OOP - Messages And the second principle: 2) Objects perform computation by making requests of each other through the passing of messages Actions in OOP are produced in response to requests for actions, called messages An instance may accept a message, and in return will perform an action and return a value To begin the process of sending the flowers, Chris gives a message to Fred. Fred in turn gives a message to the florist in Robins city, who gives another message to the driver, and so on

30 30 Information Hiding Notice that the user of a service being provided by an object, need only know the name of the messages that the object will accept The user need not know how the actions is performed Having accepted a message, an object is responsible for carrying it out

31 31 Elements of OOP - Receivers Messages differ from traditional function calls in two very important respects: In a message there is a designated receiver that accepts the message The interpretation of the message may be different, depending upon the receiver

32 32 Different Receivers, Same Message, Different Actions var Fred : Florist; Elizabeth : Friend; Ken : Dentist; begin Fred.sendFlowersTo(myFriend); { will work } Elizabeth.sendFlowersTo(myFriend); { will also work } Ken.sendFlowersTo(myFriend); { will probably not work } end; The same message will result in different actions, depending upon who it is given to

33 33 Behavior and Interpretation Although different objects may accept the same message, The actions (behavior) the object will perform will likely be different The determination of what behavior to perform may be made at run-time, a form of late binding The fact that the same name can mean two entirely different operations is one form of polymorphism

34 34 Elements of OOP Recursive Design 3) Every object has it's own memory, which consists of other objects. Each object is like a miniature computer itself - a specialized processor performing a specific task

35 Non-interference It is important that objects be allowed to perform their task however they see fit, without unnecessary interactions or interference with other objects.

35 35 Non-interference It is important that objects be allowed to perform their task however they see fit, without unnecessary interactions or interference with other objects. Instead of a bit-grinding processor... plundering data structures, we have a universe of well-behaved object that courteously ask each other to carry out their various desires -- Dan Ingalls

36 36 Ask not what you can do to your data structures, but ask what your data structures can do for you -- Timothy A. Budd

37 37 Elements of OOP - Classes 4) Every object is an instance of a class. A class groups similar objects. 5) The class is the repository for behavior associated with an object. The behavior I expect from Fred is determined from a general idea I have of the behavior of Florists We say Fred is an instance of the class Florist Behavior is associated with classes, not with individual instances All objects that are instances of a class use the same method in response to similar messages

38 38 Hierarchies of Categories But there is more that I know about Fred then just that he is a Florist I know he is a Shopkeeper, and a Human, and a Mammal, and a Material Objects, and so on At each level of abstraction I have certain information recorded That information is applicable to all lower (more specialized) levels Material Object Animal Mammal Human Shopkeeper Florist

39 39 Class Hierarchies Material Object Living Thing Non-Living Thing Animal Plant Rock Reptile Mammal Air Human Being Cat Dog Platypus Dentist Shopkeeper Artist Ken Flo Beth

40 40 Elements of OOP - Inheritance 6) Classes are organized into a singly-rooted tree structure, called an inheritance hierarchy Information (data and/or behavior) associated with one level of abstraction in a class hierarchy is automatically applicable to lower levels of the hierarchy

41 41 Elements of OOP - Overriding Subclasses can alter or override information inherited from parent classes: All mammals give birth to live young A platypus is an egg-laying mammal Inheritance combined with overriding are where most of the power of OO originates

42 42 Computing as Simulation The OOP view of computation is similar to creating a universe of interacting computing objects Similar to the way in which a committee or club might be organized Also very similar to a style of simulation called discrete event-driven simulation Easily under estimated advantage of this view -- power of metaphor

43 43 Metaphor and Problem Solving Because the OOP view is similar to the way in which people go about solving problems in real life (finding another agent to do the real work!), intuition, ideas, and understanding from everyday experience can be brought to bear on computing On the other hand, common sense was seldom useful when computers were viewed in the processstate model, since few people solve their everyday problems using pigeon-holes

object-oriented system offers larger building blocks that

44 44 From Newsweek Unlike the usual programming method -- writing software one line at a time-- NeXT's object-oriented system offers larger building blocks that developers can quickly assemble the way a kid builds faces on Mr. Potato Head.

45 45 Summary Object-oriented programming is not simply features added to a programming language. Rather, it is a new way of thinking Object-oriented programming views a program as a community of agents, termed objects Each object is responsible for a specific task An object is an encapsulation of state (data values) and behavior (operations) The behavior of objects is dictated by the object s class An object will exhibit its behavior by invoking a method (similar to executing a procedure) in response to a message Objects and classes extend the concept of abstract data types by adding the notion of inheritance

CITS2210. Object-Oriented Programming. Topic 1. Introduction and Fundamentals: Thinking Object-Oriented

CITS2210. Object-Oriented Programming. Topic 1. Introduction and Fundamentals: Thinking Object-Oriented CITS2210 Object-Oriented Programming Topic 1. Introduction and Fundamentals: Thinking Object-Oriented Summary: This topic considers the fundamental concepts behind object orientation, and why they are